|
Addgene inc
pgl4 20 hif1a prom plasmid Pgl4 20 Hif1a Prom Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgl4 20 hif1a prom plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
pgl4 20 hif1a prom plasmid - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
hre sequence Hre Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hre sequence/product/Addgene inc Average 93 stars, based on 1 article reviews
hre sequence - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
tggaatgtgtggaatgtgtctcaa gcttgcagtggaatgtgtggaatgt Tggaatgtgtggaatgtgtctcaa Gcttgcagtggaatgtgtggaatgt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tggaatgtgtggaatgtgtctcaa gcttgcagtggaatgtgtggaatgt/product/Addgene inc Average 93 stars, based on 1 article reviews
tggaatgtgtggaatgtgtctcaa gcttgcagtggaatgtgtggaatgt - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pgl4 20 vector Pgl4 20 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgl4 20 vector/product/Addgene inc Average 93 stars, based on 1 article reviews
pgl4 20 vector - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
ep4 shrna plasmid ![]() Ep4 Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ep4 shrna plasmid/product/Santa Cruz Biotechnology Average 86 stars, based on 1 article reviews
ep4 shrna plasmid - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rna interference lx 2 cells ![]() Rna Interference Lx 2 Cells, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna interference lx 2 cells/product/Santa Cruz Biotechnology Average 86 stars, based on 1 article reviews
rna interference lx 2 cells - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
Addgene inc
vector pgl4 20 hif 1α prom ![]() Vector Pgl4 20 Hif 1α Prom, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vector pgl4 20 hif 1α prom/product/Addgene inc Average 93 stars, based on 1 article reviews
vector pgl4 20 hif 1α prom - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
Journal: Cellular and Molecular Life Sciences: CMLS
Article Title: Macrophages evoke autophagy of hepatic stellate cells to promote liver fibrosis in NAFLD mice via the PGE2/EP4 pathway
doi: 10.1007/s00018-022-04319-w
Figure Lengend Snippet: PGE2-induced autophagy in HSCs was restrained by EP4 inhibitor E7046. a The mRNA level of EP4 coding gene Ptger4 in LX-2 cells. LX-2 cells were cultured with M0- or M2-conditional medium (COND) for 48 h and total RNA was isolated for real-time PCR assay. b, c The mRNA levels of Acta2, Atg5, Atg7 and Becn1 in LX-2 cells were detected by real-time PCR. LX-2 cells were cultured with M2-conditional medium or 100 ng/mL PGE2, in the presence or absence of 1 μM E7046 for 48 h. d The expression levels of LC3B-I, LC3B-II and α-SMA in LX-2 cells were determined by Western blot. Cells were cultured with 100 ng/mL PGE2, in the presence or absence of 1 μM E7046 for 48 h. The intensity of α-SMA blot was quantified with ImageJ software. The conversion ratio of LC3B-I to LC3B-II was calculated and the expression level of α-SMA was normalized to β-Actin. e Autophagosome in LX-2 cells. Cells were stained with autophagy-specific dye and analyzed by microplate reader. f The expression levels of EP4, α-SMA, COL1A1, COL3A1, Beclin-1, and LC3B in LX-2 cells were detected by Western blot. LX-2 cells were transfected with EP4 shRNA and stimulated with recombinant PGE2. g The bilayer autophagosomes and lysosomes were observed with transmission electron microscope. Scale bar = 5 μm (top panel). The panels on the bottom are higher-magnification images of the cropped regions. Scale bar = 1 μm (bottom panel). P-values were obtained by unpaired t test (two groups) or one-way ANOVA (multiple groups). *P < 0.05, **P < 0.01 and ***P < 0.001 compared with controls
Article Snippet: RNA interference LX-2 cells were transfected with
Techniques: Cell Culture, Isolation, Real-time Polymerase Chain Reaction, Expressing, Western Blot, Software, Staining, Transfection, shRNA, Recombinant, Transmission Assay, Microscopy
Journal: Cellular and Molecular Life Sciences: CMLS
Article Title: Macrophages evoke autophagy of hepatic stellate cells to promote liver fibrosis in NAFLD mice via the PGE2/EP4 pathway
doi: 10.1007/s00018-022-04319-w
Figure Lengend Snippet: The autophagy of HSCs and liver fibrosis was improved by in vivo blockade of EP4 with E7046. a The expression of EP4 coding gene Ptger4 in the liver of MCD mice. The mice were fed with MCD diet for 8 weeks and the liver homogenate was subjected to real-time PCR assay. b Representative immunofluorescence staining pictures of α-SMA (green), EP4 (red) and DAPI (blue) in the liver of mice feeding with MCS or MCD diet for 8 w. Integrated density of positive signals and the percentage of α-SMA+EP4+ cells in the staining pictures were quantified and compared between groups. Scale bar = 100 μm. c Schematic diagram of E7046 treatment to MCD mice. d Representative dot plots displaying the expression of LC3B (upper) and α-SMA (lower) gated on CD45−CD146−UVAF+ HSCs in the liver of mice. Percentage of LC3B+ and α-SMA+ cells were calculated and compared between groups. Data in bar graphs represent mean ± SD (n = 5 in each group). e The upper pictures are representative immunofluorescence staining of α-SMA (green), LC3B (red) and DAPI (blue) in the liver of mice. Scale bar = 100 μm. The lower pictures are representative Sirius red staining in the liver of mice. Scale bar = 200 μm. The percentage of α-SMA+LC3B+ cells and the integrated density of Sirius red in the staining pictures were quantified and compared between groups. P-values were obtained by unpaired t test (two groups) or one-way ANOVA (multiple groups). ***P < 0.001 between indicated groups
Article Snippet: RNA interference LX-2 cells were transfected with
Techniques: In Vivo, Expressing, Real-time Polymerase Chain Reaction, Immunofluorescence, Staining